mjhjmtu

got this script to work against a file, composed by lots of line (>500Mb) with this scheme:

odd lines: >BLA_BLA lenght_XX cov.XX
even lines: AGCAGCAGACTCAGACTACAGAT # on even lines there's a DNA sequence

Its function is to recalc value after "cov." using parameters passed by arguments and replace the older one and calc the percent amount of "G" and "C" into the DNA seq, in even lines.

So, output looks like:

> BLA_BLA lenght_XX
> nucleotidic_cov XX
> DNA seq (the same of even lines)
> GC_CONT: XX

Here's the code (only the loop):

K=$(($READLENGHT - $KMER + 1))
Y=$(echo "scale=4; $K / $READLENGHT" | bc)

while read odd; do
 echo -n "$odd##" | cut -d "_" -f 1,2,3,4 && printf "nucleotide_cov: " 
 echo "scale=4;$odd##*_ / $Y" | bc 
 read even
 echo "$even##" &&
 ACOUNT=$(echo "$even##" | sed -e "s/./&n /g" | grep -c "A") 
 GCOUNT=$(echo "$even##" | sed -e "s/./&n /g" | grep -c "G")
 CCOUNT=$(echo "$even##" | sed -e "s/./&n /g" | grep -c "C")
 TCOUNT=$(echo "$even##" | sed -e "s/./&n /g" | grep -c "T")
 TOTALBASES=$(($ACOUNT+$GCOUNT+$CCOUNT+$TCOUNT))
 GCCONT=$(($GCOUNT+$CCOUNT))
 printf "GC_CONT: " 
 echo "scale=2;$GCCONT / $TOTALBASES *100" | bc 
done < "$1"

It's incredibly slow when runs against huge text file (bigger than 500Mb) on a 16 core server. Any idea on how to increase speed of this script?

EDIT

As requested, desidered I/O provided via pastebin: https://pastebin.com/FY0Z7kUW

The percentage calculation can be reduced to a single operation like this

 echo "$even##" | awk 'x=gsub(/[ACT]/,""); y=gsub(/G/,""); printf "GC_CONT : %.2f%%b", (y*100)/(x+y) '

gsub substitutes a pattern and return the count of substitutions it has made. So that can be used to quickly calculate the percentage.

You could also process the odd and even lines in awk. It is not clear what you are doing with odd lines but your complete function can be put in a single awk -

awk -F '_' -v Y="$Y" ' if(NR%2==1) 
 printf "%s %s %s %s %snnucleotidic_cov : %.4fn",$1,$2,$3,$4,$5, ($6 / Y)
 else 
 x=gsub(/[AT]/,""); 
 y=gsub(/[GC]/,""); 
 printf "GC_CONT : %.2f%%n", (y*100)/(x+y)
 
 ' large_file

EDIT : Based on OP's requirement changed the if block for odd lines. The gsub would remove the "cov." from the number. After passing the shell variable $Y to awk , we can now divide and print in the required format.

Using a single awk script instead of multiple operations will significantly speed the operation up.

You’ve reached (to put it mildly) the limits of what can be reasonably done in the shell — you should re-write your script in something like AWK, or Perl, or Python. Using a more advanced language like those will avoid having to run multiple processes for all your text processing; you’ll be able to do it using built-in functions.

The number of cores matters little if your program isn't parallelized (much).

You could use wc and tr rather than sed and grep, which might speed things up a bit:

ACOUNT=$(echo "$even##" | tr -d [^A] | wc -m)

But really, I think the major problem is that shell, while an easy thing to program in for quick-and-dirty jobs, is just not the right tool for the job when it comes to raw processing power. I would suggest a more sophisticated programming language, like Perl or Python, which also have threading abilities (thereby allowing you to use all your cores).

You could do it in perl somewhat like this:

#!/usr/bin/perl -w
use strict;
use warnings;

my $y = ...; # calculate your Y value here
while(my $odd = <ARGV>) # Read a line from the file(s) passed
 # on the command line
 chomp $odd; # lose the newline
 my @split = split /_/, $odd; # split the read line on a "_" boundary
 # into an array
 print join("_", @split[0..3]) . "n"; # print the first four elements of the
 # array, separated by "_"
 print $split[$#split] / $y . "n"; # Treat the final element of the
 # @split array as a number, divide it
 # by $y, and output the result
 my %charcount = ( # Initialize a hash table
 A => 0,
 G => 0,
 C => 0,
 T => 0
 );
 my $even = <ARGV>; # read the even line
 chomp $even;
 foreach my $char(split //,$even) # split the string into separate
 # characters, and loop over them
 $charcount$char++; # Count the correct character
 
 my $total = $charcountA + $charcountG + $charcountC + $charcountT;
 my $gc = $charcountG + $charcountC;
 my $perc = $gc / $total;
 print "GC_CONT: $percn"; # Do our final calculations and
 # output the result

Note: not tested (beyond "does perl accept this code")

If you want to learn more about perl, run perldoc perlintro and get started ;-)

You are reading a long file line by line and executing multiple commands on each iteration. The main problem you are facing is latency of running those calculations and reading very small chunks of the file at a time.

Stephen Kitt's answer is good, you want to rewrite this in a higher level language in which you can cache file contents and run your string operations much more efficiently.

If you want to rule out the performance of the storage and file system, you can load the file from RAM using:

# mkdir /mnt/tmpfs
# mount -t tmpfs -o size=1024M tmpfs /mnt/tmpfs
# cp <input_file> /tmp/tmpfs
# <script> /tmp/tmpfs/<input_file>

This should make the process faster as much as you are I/O constrained. But it will never be as good as it could be if rewritten in C or ruby or python.